CS 177 Hands-on lab with databases Quiz #1

CS 177 Hands-on lab with databases Quiz #1

CS 177 Hands-on lab with databases Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises Quiz #1 Homework #1 Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises Al-Bawardy, Rasha F. Antonio, Dion

Berro, Reem G. Chien, Yu Fung Dharker, Nachiket S. Eunkyung, An Gansberger, Kristen M. Gupta, Madhur V. Hand, Damon Hua, Dong Karim, Halima R. Kebede, Mikael Koyama, Kaori Kwak, Yoon I. Marwin, Victor M. Mody, Manali Moorjani, Priya G. Qukub, Dunia Ryan, Caitlyn E. Williams, Bernadette Yahan, Lin Yawo, Akrodou Zhou, Leming 13 13 14 11 12 13 12

12 13 11 11 9 13 5 10 14 12 14 10 12 6 14 The International Nucleotide Sequence Database Collaboration NIH Sequin BankIt ftp Entrez NCBI GenBa nk

EMBL Submissions Updates CIB NIG DDBJ Submissions Updates getentry Submissions Updates EBI SRS EMBL Primary vs. Derivative Databases ACG TGC Curators

C TC ATCATCT TA TA G CC C G TG G AC GAG GAG A A TATAGCCG AGCTCCGATA CCGATGACAA T T G A C A C G TG

A AT T GA C TA Sequencing Centers RefSeq TA TA GC CG CG C AG TAT GenBank UniGene AT C TC ATCATCT

GAG GAG A A AT T G AC TA GA TACTTTCTT T A ATCA C Genome Assembly A TG CG C TG G C A CGTGA

A G T AT G CTGA CT ACG A TGC Labs CA A G TT TTGACA A TA T A C TA TTG GC TAA CGGA CA C C C C

A A G T G G TTATAGCCG A TA AT TATAGCCG TATAGCCG ATT TATAGCCG TG T A T T AT C Algorithms GAGA GAG A The Entrez Databases The (ever) Expanding Entrez System Journals

UniGene Books PubMed Central SNP PubMed UniSTS Nucleotid e Protein PopSet ProbeSet Entrez Genome Structure Taxonomy

CDD 3D Domains OMIM Genbank Search and retrieval of sequences Entrez is a retrieval system for searching several linked databases. It provides access to: PubMed; Nucleotide; Protein; Structure; Genome; PopSet; OMIM; Taxonomy and more. Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. BLAST selections Quiz #1 Summary: Nucleotide and protein databases

Sequence formats Lab exercises GenBank format Fasta format Sequence formats ASN.1 DNAStrider EMBL Convertible in ReadSeq (Web based) http://bimas.dcrt.nih.gov/molbio/readseq/ Fitch GCG GenBank/GB IG/Stanford or ForCon (stand-alone application) http://www.hgmp.mrc.ac.uk/embnet.news/vol6_1/ForCon/forcon.html MSF NBRF Olsen PAUP/NEXUS

Pearson/Fasta Phylip PIR/CODATA NOTE: - FASTA is a popular sequence format Plain/Raw Quiz #1 Pretty Summary: Nucleotide and protein databases Zuker Sequence formats Lab exercises - it also is a sequence similarity and homology search tool (similar to BLAST) used by EMBL-EBI Lab exercises 1) How many sequences are available in GenBank for Neanderthals? Depends on your search strategy 2) Go to Entrez nucleotide. Find all sequences for the following terms:

neander 1 Neanderthals 0 Neanderthal 1 neanderthal 1 neanderthal* 6 Homo sapiens neanderthalensis 6 2) Go to Entrez taxonomy. Try to find all sequences for Neanderthals! Quiz #1 Summary: Nucleotide and protein databases

Sequence formats Lab exercises 6 Lab exercises 4) How many nucleotide sequences are available for the house mouse Mus musculus? Try both Entrez nucleotides and Entrez taxonomy. How do you explain the difference? Entrez taxonomy 5.403.701 Entrez nucleotides 5.458.506 (Mus musculus) 5.393.552 (house mouse) 5.458.527 (Mus musculsus OR house mouse) 5) A man is found murdered in Yellowstone National Park. Few hairs of unidentified origin are recovered on the victims clothes. The samples arrive in the lab and DNA

is isolated and sequenced: CCATGCATATAAGCATGTACATAATATTATATTCTTACATAGGACATATTAACTCAATCTCATAATTCAT Formulate a hypothesis regarding the origin of the recovered hairs and potential links with the killing! Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises Canis lupus (Gray Wolf) The Poliovirus Problem VOL 297, 9 August 2002 Cello, J; Paul, A.V. & Wimmer, E.: Chemical Synthesis of Poliovirus cDNA: Generation of Infectious Virus in the Absence of Natural Template - they generated about 7.7 kilobases of single-stranded RNA genome based on the know genetic map - DNA fragments were synthesized from purified oligonucleotides (average length 69: bases) - the cDNA was then transcribed into highly infectious RNA Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises

The Poliovirus Problem 17 July 2002 Weiss, R.: Mail-Order Molecules Brew a Terrorism Debate - mail-order oligonucleotides can be used to manufacture a deadly virus - because they are so small, most oligos lack a fingerprint - call for more control and/or institutional oversight Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises The Poliovirus Problem Are these oligos so small that they lack a fingerprint ?? - search in Genbank for nucleotide sequences of the poliovirus - copy about 100 bp from a sequence of your choice and paste it into the search window of blastn, is the fragment identifiable as poliovirus? - if so, do a blastn search with a 90 bp, 80 bp, 70 bp fragment - what is the length of the shortest fragment still identifiable as poliovirus? Quiz #1 Summary: Nucleotide and

protein databases Sequence formats Lab exercises - is this fragment shorter than the average length of 69 bp used to synthesize the poliovirus? - do these oligos have a fingerprint (i.e. can typical oligos with lengths of 20-50 be assigned to a particular organism)? Homework assignment lecture #4 Explain in your own words and in simple terms the basics of the BLAST tool! - assignment is due on 6 Oct 2003, 3:30 PM - send your assignment as e-mail attachment to [email protected] (type your name and the term homework in the subject line) - maximum size: 500 words Quiz #1 Summary: Nucleotide and protein databases Sequence formats Lab exercises

Recently Viewed Presentations

  • Laboratory Equipment and Their Functions

    Laboratory Equipment and Their Functions

    Scoopula. Used to from one container to another. transfer solids. Test Tube Brush. Cleans out a test tube. Thermometer. Takes temperature (in ) Celsius. Pipette. Used for transferring very small volumes of liquids ... LABORATORY EQUIPMENT AND THEIR FUNCTIONS
  • Readability and Discourse

    Readability and Discourse

    Mother Teresa died 10 years ago Wednesday, but the legacy of the Roman Catholic nun who became a Nobel Peace Prize winner continues to inspire. The order she founded, the Missionaries of Charity, has expanded — the group says it...
  • 2 1 / 2 0 C F A

    2 1 / 2 0 C F A

    A Safety Management Plan will be developed by the AAFC Senior Leadership Team in the first half of 2012 A Safety Management System will then be implemented during 2012 and will ensure compliance with the Work Health Safety Act. Training...
  • Bonds - ScienceGeek.net

    Bonds - ScienceGeek.net

    Metallic Bonding. The chemical bonding that results from the attraction between metal cationsand the surrounding sea of electrons. Vacant . p. and . d. orbitals in metal's outer energy levels overlap, and allow outer electrons to move freely throughout the...
  • Causation:

    Causation:

    What caused Alphonse to die? Once upon a time there was a camel called Alphonse. For various reasons relating to an unfortunate accident during his birth, the camel had severe back problems.
  • Guaranteed Minimum Pensions

    Guaranteed Minimum Pensions

    TEESSIDE PENSION FUND Pensionable Pay Pensionable Pay Meaning of pensionable pay Pensionable or not Final pay - general Full time & part time employees Final pay - BIS Last 365 days Reductions & restrictions Certificate of Protections Pre 2008 &...
  • Instructions SOUTH HOLDERNESS UNDERGROUND MAP Choose a line

    Instructions SOUTH HOLDERNESS UNDERGROUND MAP Choose a line

    Ted Hughes . An iron clad giant falls to the bottom of a cliff, scattering his metal pieces over the ground. One by one his body parts come alive and search for each other, reconstructing the . Iron Man. ......
  • Unit 1: From Pre-History to Early Civilizations

    Unit 1: From Pre-History to Early Civilizations

    Early Civilizations of the Americas (Pages 198 - 205 ) This section is about: The geography and the climate of the area known today as Latin America and how these influenced the development of early civilizations there. Several significant early...