Mindfulness for Mental Health Professionals Martha P. Childers,

Mindfulness for Mental Health Professionals Martha P. Childers,

Mindfulness for Mental Health Professionals Martha P. Childers, M.A., Ed.Spec. 2013 GKCPA Annual Fall Conference November 15, 2013 1 p.m. - 2:30 p.m. Johnson County Community College 1 Contents Overview

Benefits Mindfulness-Oriented Psychotherapy Application References and Contact Information 2 Be 3 Present

4 Be Present 5 Overview of Mindfulness 6 History of Mindfulness Ancient Eastern religious practices, particularly India,

China, Tibet, and Japan 1960s, Indian guru Maharishi Mahesh Yogi brought Transcendental Meditation to U.S. 1968, Harvard cardiologist Herbert Benson tested ability to lower blood pressure (resultsno change); he later developed relaxation response 1970s, Ainslie Meares, an Australian psychiatrist, studied meditation to enhance immune system to reduce tumors 7

Clientele Readiness 36% of American use some form of alternative medicine, including herbal supplements, meditation, acupuncture, chiropracty and yoga National Center for Complementary and Alternative Medicine (National Institutes of Health) 8 Database Search Results

MedlinePlus.Gov (mindfulness NOT attention) 82 APA website (mindfulness) 338 ACA website (mindfulness)

347 PsychInfo (mindfulness in title) (2014-1975) 2,209 Google (mindfulness) 11,100,000 9

Research NIH RePORTER NIH funded for past 25 years 109 ClinicalTrials.gov privately & publicly funded 344

PubMed 2013-1982 996 10 Mindfulness Definitions Mindfulness: A moment-tomoment awareness of ones experience without judgment

Mindful awareness: deep abiding presence 11 Mindfulness Assumptions Mindfulness is a natural human capacity All human beings want health, happiness and freedom from suffering 12

Benefits Boost to working memory No known side affects Less emotional reactivity Reduced rumination Relationship satisfaction

Stress reduction Increased immune function Increase focus More cognitive flexibility Reduced psychological distress

Enhance self-insight, morality, intuition Fear modulation Increased information processing speed Improved well-being

Inexpensive (purchase books, attend Decreased task effort 13 Risks A small number of people became disoriented or anxious and experienced some negative feelings Utilizing mindfulness techniques alone

without conventional medical care for some diseases may have serious consequences Escapism 14 Jon Kabat-Zinn, pioneer in applying mindfulness to healing in America, developed the first and still most popular mindfulness-based technique in 1979 at University of Massachusetts Medical School and subsequently founded the Center for

Mindfulness in Medicine, Health Care, and Society at the Medical School. 15 Jon Kabat-Zinn http://www.youtube.com/watch?v=6aaJtBKwK9U 16 Mindfulness Practices

Informal practice: Intentionally bringing open, accepting, discerning attention to daily life. Note: clinical practice is considered informal Formal practice: Systematic meditation practices geared to cultivate mindfulness skills. 17 Elements of Mindfulness Practice

Intention: set a goal to reach it (e.g. self-exploration, stress management, selfliberation and compassion) Attention: observe internal and external experience in a discerning, nonreactive, sustained, and concentrated way Attitude: nonjudging, nonstriving, nonattachment, acceptance, patience, trust, openness, curiosity, letting go, gentleness, nonreactivity, lovingkindness, warmth, friendliness, kindness

18 Brain Changes The frontal lobe is shown to increase in size with meditation: responsible for initiating and coordinating motor movements; higher cognitive skills, such as problem solving, thinking, planning, and organizing; and

for many aspects of personality and emotional makeup. 19 Brain Changes (cont) The insular cortex is shown to increase in side with meditation: responsible for emotional awareness, self-recognition,

sense of homeostasis, music, rhythm, and language processing 20 Brain Changes (cont) Gray matter increases in left hippocampus: plays a distinct role in complex aspects of perception, movement, emotion, and cognition, each of which contributes to

the overall experiences captured in declarative memories. 21 Brain Changes (cont) Posterior cingulate cortex shows increased gray matter density: prominent role for the in pain and episodic memory retrieval, may be involved in the capacity to understand what other

people believe. This area has been defined in Alzheimers disease. 22 Brain Changes (cont) Gray matter increases in temporoparietal junction: recruited selectively for the attribution of mental states, memory, learning, involved in social cognition

23 Brain Changes (cont) Gray matter increases in Cerebellum: helps to regulate emotion and cognition 24 Brain Changes (cont)

Decrease in parietal lobe: visual and spatial 25 Brain Changes (cont) Decrease in amygdala: role in processing memory and emotional reactions, player in stress

26 Brain Changes (cont) Decrease in size of thalamus: relaying of sensory and motor signals to the cerebral cortex, and the regulation of consciousness, sleep, and alertness 27

Ted Talk: Brain Changes Sara Lazar, neurologist and psychologist who studies brain changes due to meditation at Harvard Medical School http://www.youtube.com/watch?v=m8rRzTtP7Tc 28 Benefits of Mindfulness

29 Benefits of Practice Bring unconscious values to awareness Decide whether to pursue those values Develop wholesome and skillful values (based on universal values) 30 Benefits to Psychotherapy

Strongest predictor of therapeutic outcomes is relationship variables Freud: An evenly hovering attention Perls: Attention in of itself is curative Rogers: empathy, unconditional positive regard, congruence Benefits for the Clinician Foster attention, empathy, compassion, patience, intentionality, gratitude, body awareness, presence Understand own psychodynamics, difficulties, goals

Better able to develop new adaptive behaviors Fewer symptoms of anxiety, depression, hostility, somatization, stress, obsessions, and compulsions Means of self-care Better quality of life Useful for a wide range of populations Improve ability to develop therapeutic skills Expand professional focus to include positive growth, development, and transformation 32

Mindfulness-Oriented Psychotherapy 33 Mindfulness-Oriented Psychotherapy Beginning Meditation Close eyes Relax your body Breathe in deeply

Hold it briefly Breathe out slowly and fully 3 times Open eyes 34 Mindfulness-Oriented Psychotherapy 1. Mindful therapist: personal practice of mindfulness meditation to cultivate presence in therapeutic work 2. Mindfulness-informed psychotherapy:

application of mindfulness theories and research along with Buddhist psychology 3. Mindfulness-based psychotherapy: teaching clients mindfulness skills and practice 35 1 Mindful Therapist 36

Mindful Therapist Attention and therapist presence Therapist attitudes Self-compassion and attunement Empathy and attunement with others Emotion regulation 37 Mindful Therapist Attention and Therapist Presence Attention capacity and therapeutic presence

Attitudes applied during therapy Self-compassion and self-attunement of therapist Therapist empathy attunement toward client Therapist emotion regulation and handling of countertransference 38 Mindful Therapist: Therapist Attitudes Nonstriving Nonattachment

Acceptance Nonjudging Patience Trust Openness Kindness Gentleness Nonreactivity Letting go Loving-kindness

Warmth Friendliness Curiosity 39 Mindful Therapist Self-Compassion and Attunement Ability to feel empathy for another or own suffering and wish to act on these feelings to alleviate suffering

Self-attunement requires development of a witness consciousness or in psychodynamic terms, observing ego 40 Mindful Therapist Meditation for Witness Consciousness (cont) Feel safe Close eyes Relax body

Breathe to go into meditative state (frontal lobe and insular cortex engage) Move consciousness to top of head and observe yourself Move consciousness on top of that and observe self observing self Come out of meditate state and open eyes when ready 41 Mindful Therapist Self-Compassion and Attunement (cont)

Attend to our own suffering Recognize our own suffering is not unique Begin to understand in a visceral way that all beings experience suffering Develop compassion for others and a strong desire to alleviate suffering in self and others Universality of being human helps develop self-compassion 42 Mindful Therapist

Self-Compassion and Attunement (cont) Therapists who are less accepting and more critical of themselves have been shown to be more hostile, controlling, and critical toward their clients Therapists who are more self-accepting tended to engage clients in more accepting, supportive transactions 43 Mindful Therapist

Empathy and Attunement with Others Empathy is necessary for effective therapy Research has shown that meditation strengthens empathy 44 Mindful Therapist Emotion Regulation

Research shows that mindfulness practice can help individuals regulate their emotions Attending to and regulating personal emotions, therapists can be more present and accepting of their clients Witnessing clients experience provides a place for clients emotions and sets a boundary around client and therapist experiences 45

Mindful Therapist Emotion Regulation Meditation to Dissipate Emotion Imagine putting 1T of salt in a glass of water and how it would taste Pour it into a pitcher of water Pour it into a lake Pour it into the ocean 46

2 Mindfulness-Informed Therapy 47 Individuals Possibly Unsuitable for Mindfulness-Informed Therapy People with personality disorders may require traditional counseling before they learn meditation to look deeply inside themselves

Clients who may have psychotic tendencies may not have strong enough psychic structures to practice mindfulness Individuals diagnosed with major depressive disorders may not be able to concentrate enough and meditation could potentially lead to rumination resulting in a depressive episode Some controversy about using it in cases of traumatic stress 48 Mindfulness-Informed Therapy

Impermanence Accepting What Is Conscious Responding vs Automatic Reactivity Curiosity and Investigation Paradox Interdependence Essential Nature 49 Mindfulness-Informed Therapy (cont) Recommended books:

Epstein, M. (2013). Thoughts without a thinker: Psychotherapy from a Buddhist perspective. NY: Basic Books. Kornfield, J. (2008). The wise heart: a guide to the universal teachings of Buddhist psychology. NY: Bantam Books. 50 Mindfulness-Informed Therapy Impermanence

Everything changes This too shall pass Persian Arabic Hebrew Turkish Bu da geer (yahu) 51 Mindfulness-Informed Therapy

No Self No stable, solid, unchanging entity labeled self exists Experience the ever-changing and flowing reality of self The mind changes with inconceivable rapidity. Subhuti 52 Mindfulness-Informed Therapy No Self (cont)

Explore your own self through time 13 years old 21 years old A year ago 53 Mindfulness-Informed Therapy Accepting What Is Resisting what is actually happening,

wanting things to be different than they are creates suffering Suffering based on ones relationship to what is happening Not accepting what is creates suffering Goal: no resistance 54 Mindfulness-Informed Therapy Therapists asks -What is the patient not accepting?

55 Mindfulness-Informed Therapy Conscious Responding vs Automatic Reaction Let go of habitual problem solving mode Bring to awareness difficult emotions

Feel the emotions in the body 56 Mindfulness-Informed Therapy Conscious Responding vs Automatic Reaction Insanity: Doing the same thing over and over again and expecting different results. Albert Einstein

57 Mindfulness-Informed Therapy Curiosity and Investigation Investigate own experience deeply Trust own experience Develop own beliefs on the basis of own experience Explore self to find a deep sense of self-knowing

58 Mindfulness-Informed Therapy Curiosity and Investigation (cont) Out of caring curiosity and interest, help client investigate own experience by stepping outside personal, subjective experience and take a more inquisitive, objective view. Ultimately help the client get in touch

with own instincts. 59 Mindfulness-Informed Therapy Curiosity and Investigation (cont) I have been and still am a seeker, but I have ceased to question stars and books; I have begun to listen to the teaching my blood whispers to me. Hermann Hesse, Demian

I will follow my instincts, and be myself for good or ill. John Muir 60 Mindfulness-Informed Therapy Curiosity and Investigation (cont) Instinct is a marvelous thing. It can neither be explained nor ignored. Agatha Christie, The Mysterious Affair at Styles Trust instinct to the end, even though you can give no reason. Ralph Waldo Emerson

Instinct leads me to another flow. Queen Latifah 61 Mindfulness-Informed Therapy Curiosity and Investigation (cont) Be a lamp unto yourself The Buddha 62

Mindfulness-Informed Therapy Paradox Penetrate deeply into the nature of things Accept that one simply does not know some things 63 Mindfulness-Informed Therapy Interdependence

All things are intimately connected 64 Mindfulness-Informed Therapy Interdependence (cont) butterfly effect n (Physics / General Physics) the idea, used in chaos theory, that a very small difference in the initial state of a physical system

can make a significant difference to the state at some later time 65 Mindfulness-Informed Therapy Essential Nature All beings are born with a pure and noble essence A clients essential being is

virtuous, pure, and deeply lovable 66 Mindfulness-Informed Therapy Essential Nature (cont) Go into a meditative state See yourself as a pure and noble essence, virtuous, pure, and deeply lovable 67

3 Mindfulness-Based Psychotherapy 68 Mindfulness-Based Psychotherapy Mindfulness-based stress reduction Mindfulness-based cognitive therapy Mindfulness-based eating awareness

training, art therapy, relapse prevention, relationship enhancement Dialectical behavior therapy (DBT) Acceptance and commitment therapy (ACT) 69 Mindfulness-Based Psychotherapy Mindfulness-Based Stress Reduction (MBSR) 8-week program

Up to 35 participants Meet weekly for 2 - 3 hours 6-hour silent retreat week-end after week 6 Kabat-Zinn, J., & Nhat Hanh, Thich (1990). Full catastrophe living: Using the wisdom of your body and mind to overcome pain, stress, and illness. New York: Delta. 70 Mindfulness-Based Psychotherapy Mindfulness-Based Cognitive Therapy

(MBCT) Integrates MBSR and CBT Developed in late 1990s for depression relapse prevention Segal, Z. V., Williams, J. M. G., Teasdale, J. D. and Kabat-Zinn, J. (2012). Mindfulness-based cognitive therapy for depression: A new approach to preventing relapse (2nd ed.). New York: Guilford Press. 71

Mindfulness and Cognitive Therapy Perception and thought drive emotion and behavior; change relationship to thought and change behavior Cognitive therapy: technique to change thought, resulting in changed behavior Mindfulness: emphasizes meditation as way to become aware of moment-to-moment experience, resulting in behavior change 72

Mindfulness-Based Psychotherapy Mindfulness-Based Eating Awareness Training Based on MBSR and integrates CBT. Helpful for binge eating disorder and obesity. Meditations address issues around body shape, weight, etc. Kristeller, J. L., Baer, R. A., & Quillian-Wolever, R. (2006). Mindfulness-based approaches to eating disorders. In R. A. Baer (Ed.), Mindfulness-based treatment approaches: Clinicians guide to evidence base and applications (pp. 75-91). London: Academic Press. 73

Mindfulness-Based Psychotherapy Mindfulness-Based Relationship Enhancement Modeled on MBSR to enhance relationships of relatively happy couples Loving-kindness meditations intended to generate feelings of loving and caring for partner Carson, J. W., Carson, K. M., Gil, K. M., & Baucom, D. H. (2006). Mindfulness-based relationship enhancement in couples. In R. A. Baer (Ed.), Mindfulness-based treatment approaches: Clinicians

guide to evidence base and applications (pp. 309-331). Amsterdam, Elsevier. 74 Thich Nhat Hanh http://www.youtube.com/watch?v=NJ9UtuWfs3U 19.06 75

Mindfulness-Based Psychotherapy Mindfulness-Based Art Therapy Based on MBSR Developed for medical populations, piloted for women with breast cancer. Utilizes creative process to process emotions arising from the illness, health, and healing Monti, D. A., et al. (2005). A randomized controlled trial of mindfulness based art therapy (MBAT) for women with cancer. Psycho-Oncology, 15, 363-373. 76

Mindfulness-Based Psychotherapy Mindfulness-Based Relapse Prevention Patterned after MBCT Used for drug, alcohol, and smoking. Relapse prevented through ability to act as observing witness and skills to cope with urges, etc. Marlatt, G. A., & Gordon, J. R. (Eds.). (1985). Relapse prevention: Maintenance strategies in treatment of addictive behaviors. New York:

Guillford Press. 77 Mindfulness-Based Psychotherapy Dialectical Behavior Therapy (DBT) Combines CBT, emotion regulation, and mindful awareness to treat borderline personality disorder Linehan, M. M. (1993). Cognitivebehavioral treatment of borderline personality disorder. New York: Guilford

Press. 78 Mindfulness-Based Psychotherapy Acceptance and Commitment Therapy Uses acceptance and mindfulness with commitment to goals and values along with behavior change strategies. Hayes, S. C., Strosahl, K., & Wilson, K. G. (1999). Acceptance and commitment therapy. New York: Guilford Press.

79 Application 80 Some Mindfulness Practices Sitting Transcendental Meditation Affirmations

Walking Martial arts: e.g. tai chi, karate, judo, aikido Make the familiar new again Concentrate on a thought, mantra, activity or image Breathe

Yoga Mindful Pay attention eating Body Scan Rest quietly and observe breathing and thoughts Awaken the senses Visualizing Zen meditation

Focus on breathing Contemplation 81 Mindfulness Meditations for Kids Deep breathing: sit in quiet place, inhale slowly through nose deep into lungs, hold 5 seconds, release slowly. Muscle relaxation: contract group of muscles tightly. Hold for 5 seconds. Release. Repeat 5 times. Visualization: close eyes, picture peaceful place or

event and heart happy sounds, imagine stress flowing away from body; or visualize competitive sport activity 82 Mindfulness for Medical Conditions Alzheimers: reduce loneliness and isolation, linked to increase risk Asthma: improve Blood cortisol levels (Stress hormones): reduce Brain: relax, focus on current moment, go with flow

of thoughts and sensations Cancer: reduce stress hormones that bind with cancer cells, making cells more invasive, relieve anxiety , depression, distress, fatigue, mood, sleep disturbances, improve quality of life, improve positive outcomes 83 Mindfulness for Medical Conditions (cont) Cholesterol: reduce Colds: relief

Deep belly fat: decrease Eating: more balanced and emotional regulation Fertility: increase Fibromyalgia: decreases Health care services: reduce usage 84 Mindfulness for Medical Conditions (cont) Heart disease: less lonely, less stress, reverse carotid atherosclerosis

Heritable disorders of connective tissue: ameliorates pain High blood pressure: reduce Inflammation: reduce levels of proteins linked to inflammation (heart disease, Alzheimers); reducing loneliness reduces inflammation Irritable bowel syndrome: relief Longevity: increase Menopause: reduce hot flashes 85

Mindfulness for Medical Conditions (cont) Poor health: reduce Osteoporosis: tai chi to maintain bone density Respiratory infections: reduce Rheumatoid arthritis: improve quality of life and reduce psychological distress Sleep: improve Stress: linked to heart disease, compromised immune system functioning, premature cellular and cognitive aging 86

Mindfulness for Psychological Health Anxiety: reduce long-term Caregivers: feel less lonely, isolated, depressed, less emotional stress Chronic pain: reduce Cognitive decline: decrease or prevent Depression: reduce Emotion regulation and control: improve Emotional stress: decrease, focus, decrease feelings of overwhelm and depression

Focus: improve 87 Mindfulness for Psychological Health (cont) Inflammation: reduces levels of proteins linked to inflammation (heart disease, Alzheimers) Learning: improve Life satisfaction: improve Memory and mental clarity: improve Mood: improve

Negative thinking: reduce Perspective taking: improve PTSD: useful for treatment Quality of life: improve 88 Mindfulness for Psychological Health (cont) Relationships: possibly improve Relaxation: increase Self-awareness: increase Smoking: reduced; area of brain linked to self-control

shown to be more active Stress: reduce, improve coping strategies Sports: help children and athletes focus on present, reduce nervous energy; positive affirmations I learn from my mistakes Im in control of my feelings I can make this goal Values: clarify 89 Anxiety Meditation Go into meditative state

Recall an unpleasant memory causing anxiety Notice physical feelings Stay with the physical feelings until they dissipate or until concentration ends Come out of meditative state 90 Decision-Making Meditation Go into a meditative state Feel heart and remember the feeling

Think of one option Feel heart and remember the feeling Think of another option Feel heart and remember the feeling Come out of meditative state and asset feelings to make decision 91 Six Focusing Movements: Meditation for Self-Healing

Clearing a space: Ask yourself, How do I feel? Felt sense of the problem: Ask yourself, Which problem is the worst? Finding a handle: Name the problem Resonating handle and felt sense: Ask, Is the handle right? Adjust the handle as needed Asking: Ask the problem Receiving: Listen to the response Gendlin, E. T. (1981). Focusing. New York: Bantam Books. 92

Discussion Ethical concerns about using mindfulness techniques with clients Overcoming resistance in clients Effective mindfulness techniques Locations to learn mindfulness 93 A Selection of Resources American Psychological Association website Brainfacts.org

Kabaat-Zinn, J. (2012). Mindfulness for beginners: Reclaiming the present moment and your life. Boulder, CO: Sounds True. Meditation and Brain Changes: Recent Research and New Applications. (June 25, 2012) Jon Lieff. (Retrieved Nov. 13, 2013, from http:// jonlieffmd.com/blog/meditation-and-brain-changes-recent-research-and -new-applications ) MedlinePlus.gov Nhat Hanh, Thich. (1987). The miracle of mindfulness: An introduction to the practice of meditation. Boston: Beacon Press.

PubMed.gov Shapiro, S.L., & Carlson, L. E. (2009). The Art and science of 94 mindfulness. Washington, D.C.: American Psychological Association. Martha P. Childers, M.A., Ed. Spec. [email protected] 816-892-0803 95

Recently Viewed Presentations

  • How To Succeed in Math Class

    How To Succeed in Math Class

    This is my second year teaching sixth grade math. Expectations. Arrive to your seat on time and prepared. Remain seated unless told otherwise. ... Mrs. Beal will give you each a number for math class; this will be used for:...
  • Changing policing and policing change: placing Scotland in

    Changing policing and policing change: placing Scotland in

    'Changing policing and policing change': placing Scotland in a comparative context Nick Fyfe Why? Forces for Change Economic - the search for 'affordable policing'; Social/managerial - responding to changing patterns of criminality; Political/ideological - reshaping relations between state and civil...
  • Raspberry Pi - Fermilab

    Raspberry Pi - Fermilab

    GPIO Pin Characteristics. 3.3V. source or sink 16mA (100mA total) Push-pull, pullup, pulldown drive (~50K, except on pins 3,4 with 1.8K pullup ) Can generate pulses around 50nS (interrupted by scheduler 0.6uS every 125uS and 15uS every 10ms) Practical pulse...
  • The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

    The Effect of A Low-Fat, High-Fiber, Fruit- and Vegetable ...

    What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer • Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats
  • History of Forensic Science - Lawndale High School

    History of Forensic Science - Lawndale High School

    Leone Lattes (1887-1954) In 1915 he devised simple technique to determine the blood group of a dried blood stain. Blood groups A, B, AB, & O were discovered in 1901 by someone else . Calvin Goddard (1891-1955)
  • Welcome To Our Classroom - University of North Carolina at ...

    Welcome To Our Classroom - University of North Carolina at ...

    General Rules Abide by all NBHS rules - dress code, conduct etc. If you must, you may eat something small in class, but don't let it become a distraction & clean up. If this poses a problem, I will not...
  • Of The Edgar full biography Allan Poenow. was

    Of The Edgar full biography Allan Poenow. was

    Queen of May Ode- This poem was published around . April, 1836. Richmond, VA- This city is where Poe married his wife, Virginia, and spent some time in his earlier years. He also served as a lieutenant for the color...
  • Lesson 6: User Input and Strings - Birmingham Schools

    Lesson 6: User Input and Strings - Birmingham Schools

    PURPOSE:you are introduced to the string data type as a way of representing arbitrary sequences of ASCII characters. You will use strings to accept input from a user as you work on mastering two new UI elements, the text input...