Transcription and Translation

Transcription and Translation Chapter 14 p. 263-273 Protein Structure Made up of amino acids Polypeptide- string of amino acids

20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome Questions to be answered today How do we get from the bases found in DNA to amino acids? How do we get from a bunch of

amino acids to proteins? Replication DNA DNA double helix unwinds DNA now single-stranded New DNA strand forms using complementary base pairing (A-T, C-G) Used to prepare DNA for cell division Whole genome copied/replicated Transcription and Translation: An Overview (aka the Central Dogma)

DNA Transcription RNA Translation Protein RNA vs. DNA

DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar

Bases: C,G,A,U Both contain a sugar, phosphate, and base. Transcription RNA forms base pairs with DNA

C-G A-U Primary transcriptlength of RNA that results from the process of transcription TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACU

Major players in transcription mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus

Major players in transcription RNA polymerasecomplex of enzymes with 2 functions: Unwind DNA sequence Produce primary

transcript by stringing together the chain of RNA nucleotides mRNA Processing Primary transcript is

not mature mRNA DNA sequence has coding regions (exons) and non-coding regions (introns) Introns must be removed before primary transcript is mRNA and can leave nucleus Transcription is donewhat now? Now we have mature mRNA

transcribed from the cells DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we read the code? Translation Second stage of protein production

mRNA is on a ribosome Ribosomes 2 subunits, separate in cytoplasm until they join to begin translation Large Small Contain 3 binding sites

E P A Translation Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome

tRNA Transfer RNA Bound to one amino acid on one end Anticodon on the other end

complements mRNA codon tRNA Function Amino acids must be in the correct order for the protein to function correctly tRNA lines up amino acids using mRNA code

Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA

bases How many bases code for each amino acid? 1 base = 1 amino acid 41 = 2 bases = 1 amino acid 42 =

3 bases = 1 amino acid 43 = The Genetic Code ACGATACCCTGACGAGCGTTAGCTATCG UGCUAUGGGACUG Which codons code for which amino acids?

Genetic code- inventory of linkages between nucleotide triplets and the amino acids they code for A gene is a segment of RNA that brings about transcription of a segment of RNA Transcription vs. Translation Review

Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA

Occurs in the nucleus DNA mRNA Translation Process by which

information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein

Recently Viewed Presentations

  • Arms Control and the Laws of War Lesson

    Arms Control and the Laws of War Lesson

    Arms Control and the Laws of War * * * * * * * * * * * * * * * * * * * * * * Arms Limitation Washington Naval Treaty (1922) Other Limits: • All other...
  • Storage Infrastructure Management The IBM Storage Integration ...

    Storage Infrastructure Management The IBM Storage Integration ...

    My job is to share a higher level view of IBMs perspective on how we have internalized the feedback we have received from customers like you - how we can help you deal with today's IT challenges - how storage...
  • UNCLASSIFIED Air Force Sustainment Center Silicon Slopes HAFB

    UNCLASSIFIED Air Force Sustainment Center Silicon Slopes HAFB

    Air Force divided up into 10 major commands, Hill AFB falls under Air Force Materiel Command. AFMC Divided up into 6 major centers. Hill AFB falls under Air Force Sustainment Center. Mission: The mission of the Air Force Sustainment Center...
  • Social Psychology - Administration

    Social Psychology - Administration

    Social Facilitation and Inhibition. Research shows that the presence of others can either facilitate or inhibit your performance. In social facilitation an audience tends to aid your performance if it is a task you know well. In social inhibition an...
  • Can agroforestry reduce risk in subsistence agriculture under ...

    Can agroforestry reduce risk in subsistence agriculture under ...

    Can agroforestry increase reliability of subsistence agriculture under future climate in southern Africa? Amber Kerr Ph.D. Qualifying Examination Energy and Resources Group November 16, 2007 Talk outline Motivation and background Climate change and agroforestry Why is southern Africa a good...
  • 2006 Body of Knowledge Report FEMA Higher Education Project

    2006 Body of Knowledge Report FEMA Higher Education Project

    2009 Body of Knowledge Report: The Practitioner's Viewpoint FEMA Emergency Management ... Introduction to Emergency Management (Haddow & Bullock) NIMS 2 Disasters by Design: A Reassessment of Natural Disasters in the U.S. (Mileti) Living with Hazards, Dealing with Disaster (Waugh)...
  • Example NOTAMs - RAL

    Example NOTAMs - RAL

    !LGA LGA RWY 13 FICON 1/1/1 100 PRCT WET ICE OBSERVED AT 1701040230. CONDITIONS NOT MNT 1701040300-1701061045. 1701040253-1701061115 . Runway . 13 is the landing runway and is . 100 % covered by wet ice but the Runway Condition Code...
  • LA PERSPECTIVE DU NOUVEAU-BRUNSWICK Congrs national du RCCFC

    LA PERSPECTIVE DU NOUVEAU-BRUNSWICK Congrs national du RCCFC

    LA PERSPECTIVE DU NOUVEAU-BRUNSWICK Congrès national du RCCFC 1er novembre 2007 Saisir l'occasion : plan d'action visant à procurer un avantage stratégique au Nouveau-Brunswick VISION Axé sur les étudiants Bilingue / développement égal Accès dans toutes les régions Système intégré...